SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


2-dehydro-3-deoxy-phosphogluconate aldolase
20.72 kDa
protein length
196 aa Sequence Blast
gene length
591 bp Sequence Blast
utilization of galacturonic acid
2-dehydro-3-deoxy-phosphogluconate aldolase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of hexuronate]
  • Gene

    2,323,009 2,323,599

    The protein

    Catalyzed reaction/ biological activity

  • 4-hydroxy-2-oxoglutarate --> glyoxylate + pyruvate (according to UniProt)
  • 2-dehydro-3-deoxy-6-phospho-D-gluconate --> D-glyceraldehyde 3-phosphate + pyruvate (according to UniProt)
  • Protein family

  • KHG/KDPG aldolase family (single member, according to UniProt)
  • Structure

  • [PDB|1VLW] (from Thermotoga maritima, 41% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9846747], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR]: repression, [Pubmed|9846747], in [regulon|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|9846747], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR]) [Pubmed|9846747]
  • view in new tab

    Biological materials


  • BKE22100 ([gene|826BFCE6ED2113BB0510E798C6CDB05C4665E0E2|kdgA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTTCAACGACTTTGGACT, downstream forward: _UP4_TAAGTGGAATTGTTTTTTCA
  • BKK22100 ([gene|826BFCE6ED2113BB0510E798C6CDB05C4665E0E2|kdgA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTTCAACGACTTTGGACT, downstream forward: _UP4_TAAGTGGAATTGTTTTTTCA
  • References

  • 9846747