SubtiBank SubtiBank
sigZ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

sigZ

[SW|RNA polymerase] ECF-type [SW|sigma factor] SigZ
locus
BSU_26840
pI
6.24
mw
20.57 kDa
protein length
176 aa Sequence Blast
gene length
531 bp Sequence Blast
function
[category|SW 3.2.1|Transcription]
product
[SW|RNA polymerase] ECF-type [SW|sigma factor] SigZ
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.2|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.1|Sigma factors]
  • Gene

    Coordinates
    2,742,244 2,742,774

    The protein

    Protein family

  • [SW|Sigma-70 factor family] (according to UniProt)
  • [SW|ECF subfamily] (according to UniProt)
  • Structure

  • [PDB|5WUQ] ([protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW], 29% identity) [pubmed|28319136]
  • Biological materials

    Mutant

  • MGNA-A143 (sigZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/143 NBRP B. subtilis, Japan]
  • 1A902 ( ''sigZ''::''kan''), [Pubmed|15838020], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A902&Search=1A902 BGSC]
  • BKE26840 ([gene|826F81933BE84AEF0C71EE9B90390B14B4CB0E9F|sigZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAAAAACCTCCTAT, downstream forward: _UP4_TAACTGATGAACATAGTCAG
  • BKK26840 ([gene|826F81933BE84AEF0C71EE9B90390B14B4CB0E9F|sigZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAAAAACCTCCTAT, downstream forward: _UP4_TAACTGATGAACATAGTCAG
  • References

    Reviews

  • 24921931
  • Original publications

  • 17675383,20817771,27137497,28319136