SubtiBank SubtiBank
mcpC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

mcpC

membrane-bound chemotaxis receptor for proline, methyl-accepting chemotaxis protein
locus
BSU_13950
pI
5.17
mw
71.93 kDa
protein length
655 aa Sequence Blast
gene length
1968 bp Sequence Blast
function
control of chemotaxis to proline, threonine, glycine, serine, lysine, valine and arginine
product
methyl-accepting chemotaxis protein
essential
no
synonyms
prg71

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.4|Membrane-bound chemoreceptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,463,628 1,465,595

    The protein

    Catalyzed reaction/ biological activity

  • deaminated [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|McpC] stimulates phosphorylation of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|CheA] [Pubmed|22931217]
  • Paralogous protein(s)

  • [protein|E4E1020B799A1B403BDB4847B91B02D64D161AF3|McpB], [protein|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|McpA], [protein|1DE26CDEE952142C1303C822F0E2A63AE09F721B|TlpA], [protein|4CD44AD8FE68516C84889EAA2137828E06B8A30B|TlpB]
  • [SW|Domains]

  • [SW|Cache domain] (aa 148-225) (according to UniProt)
  • [SW|HAMP domain] (aa 298-350) (according to UniProt)
  • [SW|Methyl-accepting transducer domain] (aa 369-619) (according to UniProt)
  • Modification

  • deamination of Gln-609 (by [protein|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|CheD]) [Pubmed|22931217], deaminated [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|McpC] stimulates phosphorylation of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|CheA] [Pubmed|22931217]
  • Structure

  • [PDB|6S1K] (from E. coli, corresponds to aa 279 ... 593, 26% identity) [pubmed|31925330]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711,21515776]
  • Expression and Regulation

    Operons

    genes
    [gene|8333CD46F704F03A22482CAA98DEFCC945362A10|mcpC]
    description
    [Pubmed|9353924]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9353924], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • additional information

  • in minimal medium, McpC is present with 2,800 /- 640 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials

    Mutant

  • DS180 (''mcpC''::''mls'' in NCIB3610) [Pubmed|12864845]
  • BKE13950 ([gene|8333CD46F704F03A22482CAA98DEFCC945362A10|mcpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCAATCCCCTCCTAAT, downstream forward: _UP4_TAATCCAATTACATCCCCAA
  • BKK13950 ([gene|8333CD46F704F03A22482CAA98DEFCC945362A10|mcpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCAATCCCCTCCTAAT, downstream forward: _UP4_TAATCCAATTACATCCCCAA
  • References

  • 12864845,15317802,8251536,9353924,15544802,6137212,9721285,2505839,2105313,12603740,23038252,18763711,9721285,21515776,22931217,27899502,31925330