SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


L-serine deaminase
30.78 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast
serine utilization
L-serine deaminase (alpha chain)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of alanine/ serine]
  • Gene

    1,658,930 1,659,832

    Phenotypes of a mutant

  • delayed [SW|biofilm formation] [pubmed|31138626]
  • The protein

    Catalyzed reaction/ biological activity

  • L-serine --> NH4+ + pyruvate (according to UniProt)
  • Protein family

  • iron-sulfur dependent L-serine dehydratase family (with [protein|BC19D5B3764503298ED7136FC9F63A68F6AC464F|SdaAB], according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [Pubmed|22686449]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE15860 ([gene|8361D87307D2E8350945F592ABD24E2109E2E81A|sdaAA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACTGGCTCCTCCTGAC, downstream forward: _UP4_ATTTTCGGAGGAGCGCTAGG
  • BKK15860 ([gene|8361D87307D2E8350945F592ABD24E2109E2E81A|sdaAA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACTGGCTCCTCCTGAC, downstream forward: _UP4_ATTTTCGGAGGAGCGCTAGG
  • References

  • 22383849,22686449,24161940,31138626