SubtiBank SubtiBank
sdaAA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sdaAA

L-serine deaminase
locus
BSU_15860
pI
4.87
mw
30.78 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast
function
serine utilization
product
L-serine deaminase (alpha chain)
essential
no
ec
4.3.1.17
synonyms
ylpA,sdaA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.7|Utilization of alanine/ serine]
  • Gene

    Coordinates
    1,658,930 1,659,832

    Phenotypes of a mutant

  • delayed [SW|biofilm formation] [pubmed|31138626]
  • The protein

    Catalyzed reaction/ biological activity

  • L-serine --> NH4+ + pyruvate (according to UniProt)
  • Protein family

  • iron-sulfur dependent L-serine dehydratase family (with [protein|BC19D5B3764503298ED7136FC9F63A68F6AC464F|SdaAB], according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [Pubmed|22686449]
  • Expression and Regulation

    Operons

    genes
    [gene|BC19D5B3764503298ED7136FC9F63A68F6AC464F|sdaAB]-[gene|8361D87307D2E8350945F592ABD24E2109E2E81A|sdaAA]-[gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE15860 ([gene|8361D87307D2E8350945F592ABD24E2109E2E81A|sdaAA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACTGGCTCCTCCTGAC, downstream forward: _UP4_ATTTTCGGAGGAGCGCTAGG
  • BKK15860 ([gene|8361D87307D2E8350945F592ABD24E2109E2E81A|sdaAA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACTGGCTCCTCCTGAC, downstream forward: _UP4_ATTTTCGGAGGAGCGCTAGG
  • References

  • 22383849,22686449,24161940,31138626