SubtiBank SubtiBank
licC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

licC

lichenan-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIC of the [category|SW 1.2.2|PTS]
locus
BSU_38580
pI
8.58
mw
48.37 kDa
protein length
452 aa Sequence Blast
gene length
1359 bp Sequence Blast
function
lichenan uptake and phosphorylation
product
lichenan-specific lichenan-specific [category|SW 1.2.2|PTS], EIIC component
essential
no
synonyms
celB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,960,192 3,961,550

    The protein

    Protein family

  • [category|SW 1.2.2|PTS] permease, lactose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|0650C9EAB395EB6ABDADBE72F0DA9F8E5E606B0E|YwbA], [protein|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|GmuC]
  • Structure

  • [PDB|3QNQ] (EIIC component of diacetylchitobiose specific PTS from ''Bacillus cereus''; 60% identity, 87% similarity) [Pubmed|21471968]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]-[gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]-[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]-[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]
    description
    [Pubmed|8990303]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8990303], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8990303], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|LicR]: activation, [Pubmed|8990303], in [regulon|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|LicR regulon]
  • regulation

  • carbon catabolite repression ([protein|search|CcpA]) [Pubmed|8990303]
  • view in new tab

    Biological materials

    Mutant

  • BKE38580 ([gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATAGCCCGCCCCTCTCT, downstream forward: _UP4_CTGTAGAGAAAGGAAGTGAA
  • BKK38580 ([gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATAGCCCGCCCCTCTCT, downstream forward: _UP4_CTGTAGAGAAAGGAAGTGAA
  • References

  • 19087206,8990303,16872404,10438772,10627040,8990303