SubtiBank SubtiBank
opuCB [2018-12-18 17:47:20]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

opuCB [2018-12-18 17:47:20]

glycine betaine/carnitine/choline/arsenobetaine/arsenocholine [SW|ABC transporter]
23.00 kDa
protein length
217 aa Sequence Blast
gene length
651 bp Sequence Blast
compatible solute transport
glycine betaine/carnitine/choline/arsenobetaine/arsenocholine [SW|ABC transporter]

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of compatible solutes for osmoprotection]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,469,184 → 3,469,837

    The protein

    Catalyzed reaction/ biological activity

  • uptake of glycine betaine, arsenocholine and arsenobetaine [pubmed|29159878]
  • Protein family

  • CysTW subfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|OpuBB]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation



    regulatory mechanism

  • [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR]: repression, (sterical interference with RNA polymerase access) [Pubmed|32849357,23960087], in [regulon|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR regulon]
  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • induced by salt stress [Pubmed|23960087,10216873]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • BKE33820 (Δ[gene|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAAAAGAGCTCCTCC, downstream forward: _UP4_TCGTAAGGAGTTGGCACTGT
  • BKK33820 (Δ[gene|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAAAAGAGCTCCTCC, downstream forward: _UP4_TCGTAAGGAGTTGGCACTGT
  • References


  • 27935846
  • Original publications

  • 10092453,9925583,10216873,21296969,23960087,23646920,29159878