SubtiBank SubtiBank
yaaC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yaaC

unknown
locus
BSU_00080
pI
7.79
mw
37.82 kDa
protein length
315 aa Sequence Blast
gene length
948 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    14,847 15,794

    Expression and Regulation

    Operons

    genes
    [gene|84A74D4CA5812B7E737F28362411EA55685671E9|yaaC]
    description
    (chromosomal arrangement) null
    view in new tab

    Biological materials

    Mutant

  • MGNA-B886 (yaaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1885 NBRP B. subtilis, Japan]
  • BKE00080 ([gene|84A74D4CA5812B7E737F28362411EA55685671E9|yaaC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATATTTCTTAATCCT, downstream forward: _UP4_TAACAAACAAAAAACCCAGC
  • BKK00080 ([gene|84A74D4CA5812B7E737F28362411EA55685671E9|yaaC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATATTTCTTAATCCT, downstream forward: _UP4_TAACAAACAAAAAACCCAGC