SubtiBank SubtiBank
lctP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

lctP

lactate permease, excretion
locus
BSU_03060
pI
9.77
mw
57.49 kDa
protein length
541 aa Sequence Blast
gene length
1626 bp Sequence Blast
function
lactate excretion
product
L-lactate permease
essential
no
synonyms
ycgC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.5|Overflow metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    330,771 332,396

    The protein

    Protein family

  • lactate permease family (with [protein|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|LutP], according to UniProt)
  • Paralogous protein(s)

  • [protein|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|LutP]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A0DD68FE90FD13DF03496321AB2DAAADF9F4230D|ldh]-[gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]
    description
    [Pubmed|16207915]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10809684], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, [Pubmed|16207915], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • regulation

  • induced under anaerobic conditions ([protein|search|Rex]) [Pubmed|16207915]
  • view in new tab

    Biological materials

    Mutant

  • BKE03060 ([gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGACAATCAGCCCTTTA, downstream forward: _UP4_TAATAGAAAAAAGCAGTACA
  • BKK03060 ([gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGACAATCAGCCCTTTA, downstream forward: _UP4_TAATAGAAAAAAGCAGTACA
  • GP2578 ([gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab
  • References

  • 16207915,10809684,16428414,17573341