SubtiBank SubtiBank
licH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

licH

6-phospho-beta-glucosidase
locus
BSU_38560
pI
5.18
mw
48.55 kDa
protein length
442 aa Sequence Blast
gene length
1329 bp Sequence Blast
function
lichenan utilization
product
6-phospho-beta-glucosidase
essential
no
ec
3.2.1.86
synonyms
celD,celF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • Gene

    Coordinates
    3,958,516 3,959,844

    The protein

    Catalyzed reaction/ biological activity

  • 6-phospho-β-D-glucosyl-(1→4)-D-glucose + H2O --> D-glucose + D-glucose 6-phosphate (according to UniProt)
  • Protein family

  • [SW|Glycosyl hydrolase 4 family] (according to UniProt)
  • Structure

  • [PDB|1S6Y] (Geobacillus stearothermophilus)
  • Expression and Regulation

    Operons

    genes
    [gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]-[gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]-[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]-[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]
    description
    [Pubmed|8990303]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8990303], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8990303], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|LicR]: activation, [Pubmed|8990303], in [regulon|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|LicR regulon]
  • regulation

  • carbon catabolite repression ([protein|search|CcpA]) [Pubmed|8990303]
  • view in new tab

    Biological materials

    Mutant

  • BKE38560 ([gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTTACAATCTTCAATCCTT, downstream forward: _UP4_TAAAAAAAGCCGGCCTGTAA
  • BKK38560 ([gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTTACAATCTTCAATCCTT, downstream forward: _UP4_TAAAAAAAGCCGGCCTGTAA
  • References

  • 19087206,8990303,16872404,10438772,8990303