SubtiBank SubtiBank
pksR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

pksR

polyketide synthase
locus
BSU_17220
pI
5.44
mw
284.73 kDa
protein length
2543 aa Sequence Blast
gene length
7632 bp Sequence Blast
function
polyketide synthesis
product
polyketide synthase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    1,850,890 1,858,521

    The protein

    [SW|Domains]

  • 3 [SW|Carrier domain]s (aa 376-452, aa 1407-1485, aa 2134-2208) (according to UniProt)
  • Structure

  • [PDB|4U3V] (enoyl-isomerase domain, aa 1124-1395) [Pubmed|25089587]
  • Expression and Regulation

    Operons

    genes
    [gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|24187085], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|24187085], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed during the transition from growth to stationary phase ([protein|search|AbrB], [protein|search|CodY]) [Pubmed|24187085]
  • additional information

  • this is a very large operon comprising about 75 kb
  • view in new tab

    genes
    [gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]-[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A018 (pksR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/18 NBRP B. subtilis, Japan]
  • BKE17220 ([gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCAGCATTGGCGTTTCCC, downstream forward: _UP4_TGAGAAAACACAAACGCCCC
  • BKK17220 ([gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCAGCATTGGCGTTTCCC, downstream forward: _UP4_TGAGAAAACACAAACGCCCC
  • References

  • 10960106,25089587,17190806,22383849,24187085