SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


carboxy-terminal processing serine protease, cleaves [protein|AB2A3422277040107AAF90358BBE58608F8E0738|SpoIVFA], this results in processing of pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]
52.63 kDa
protein length
480 aa Sequence Blast
gene length
1443 bp Sequence Blast
control of [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK] activation
carboxy-terminal processing serine protease, cleaves [protein|AB2A3422277040107AAF90358BBE58608F8E0738|SpoIVFA]

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    3,622,356 3,623,798

    The protein

    Protein family

  • Peptidase s41a family (together with [protein|5ED8301B9681FDD5171A9344A971E891493A6558|CtpA], according to Uniprot)
  • PDZ protease [Pubmed|24243021]
  • Paralogous protein(s)

  • [protein|5ED8301B9681FDD5171A9344A971E891493A6558|CtpA]
  • [SW|Domains]

  • signal peptide (aa 1 - 23) (according to Uniprot)
  • [SW|PDZ domain] (aa 92 - 182) (according to Uniprot)
  • S41 peptidase domain (by similarity to [protein|5ED8301B9681FDD5171A9344A971E891493A6558|CtpA]) [pubmed|29979679]
  • peptidoglycan binding domain (C-terminal) (by similarity to [protein|5ED8301B9681FDD5171A9344A971E891493A6558|CtpA]) [pubmed|29979679]
  • Effectors of protein activity

  • substrate binding of CtpB induces opening of the PDZ gate and protease activation [Pubmed|24243021]
  • [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB] acts in concert with a second signaling protease, [protein|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|SpoIVB] [Pubmed|24243021]
  • Structure

  • [PDB|4C2C] [Pubmed|24243021]
  • forms a ring-like scaffold with two narrow tunnels for substrate binding [Pubmed|24243021]
  • [SW|Localization]

  • intracellular space between the mother cell and the forespore [Pubmed|24243021]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE], [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]) [Pubmed|15699190,16497325]
  • view in new tab

    Biological materials


  • MGNA-A074 (yvjB::erm), available at the [ NBRP B. subtilis, Japan]
  • 1S129 ( ''ctpB''::''tet''), [Pubmed|14526016], available at [ BGSC]
  • BKE35240 ([gene|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTACTCCTCCTGTA, downstream forward: _UP4_TAAAGGAGATGGTATTTCAT
  • BKK35240 ([gene|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTACTCCTCCTGTA, downstream forward: _UP4_TAAAGGAGATGGTATTTCAT
  • References

  • 14526016,17557826,16818230,15699190,16497325,24243021