SubtiBank SubtiBank
ctpB
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

ctpB

carboxy-terminal processing serine protease, cleaves SpoIVFA, this results in processing of pro-SigK
locus
BSU35240
pI
8.64
mw
52.63 kDa
protein length
480 aa Sequence Blast
gene length
1440 bp Sequence Blast
function
control of SigK activation
product
carboxy-terminal processing serine protease, cleaves SpoIVFA
essential
no
synonyms
yvjB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,622,356 → 3,623,798

    The protein

    Protein family

  • PDZ protease [Pubmed|24243021]
  • Paralogous protein(s)

  • [protein|5ED8301B9681FDD5171A9344A971E891493A6558|CtpA]
  • Effectors of protein activity

  • substrate binding of CtpB induces opening of the PDZ gate and protease activation [Pubmed|24243021]
  • [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB] acts in concert with a second signaling protease, [protein|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|SpoIVB] [Pubmed|24243021]
  • Structure

  • [PDB|4C2C] [Pubmed|24243021]
  • forms a ring-like scaffold with two narrow tunnels for substrate binding [Pubmed|24243021]
  • [SW|Localization]

  • intracellular space between the mother cell and the forespore [Pubmed|24243021]
  • Expression and Regulation

    Operons

    genes
    [gene|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/ctpB.html DBTBS]) null

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE], [protein|search|SigG]) [Pubmed|15699190,16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A074 (yvjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/74 NBRP B. subtilis, Japan]
  • 1S129 ( ''ctpB''::''tet''), [Pubmed|14526016], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S129&Search=1S129 BGSC]
  • BKE35240 (Δ[gene|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTACTCCTCCTGTA, downstream forward: _UP4_TAAAGGAGATGGTATTTCAT
  • BKK35240 (Δ[gene|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTACTCCTCCTGTA, downstream forward: _UP4_TAAAGGAGATGGTATTTCAT
  • References

  • 14526016,17557826,16818230,15699190,16497325,24243021