SubtiBank SubtiBank
yyaN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yyaN

similar to transcriptional regulator ([SW|MerR family])
locus
BSU_40800
pI
9.31
mw
15.91 kDa
protein length
138 aa Sequence Blast
gene length
417 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    4,189,796 4,190,212

    The protein

    Protein family

  • [SW|MerR family]
  • Structure

  • [PDB|3QAO] (from Listeria monocytogenes, 29% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|852ECFA6F254167090AA393E6E0D269F49A4CC6E|yyaN]-[gene|D9D907A6004AFE7A4D7BB92A8955593F00DC7A2C|yyaM]-[gene|56A5266F8F42E0FCFDE941CB71AD103120CEB5E9|yyaL]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-B860 (yyaN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1859 NBRP B. subtilis, Japan]
  • BKE40800 ([gene|852ECFA6F254167090AA393E6E0D269F49A4CC6E|yyaN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCCCTCTCATTTAAT, downstream forward: _UP4_TTGAAAGAGGAAGTGGAAAA
  • BKK40800 ([gene|852ECFA6F254167090AA393E6E0D269F49A4CC6E|yyaN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCCCTCTCATTTAAT, downstream forward: _UP4_TTGAAAGAGGAAGTGGAAAA