SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


protein serine phosphatase, feedback PP2C, dephosphorylates RsbS and RsbR
22.00 kDa
protein length
199 aa Sequence Blast
gene length
600 bp Sequence Blast
control of SigB activity
protein serine phosphatase, feedback PP2C

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    523,650 524,249

    The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR]-P [Pubmed|15466036] and [protein|841CE7FCA4E84445830CA18F9856F6F30014E3BB|RsbS]-S59-P [Pubmed|8824586,21362065]
  • H2O + O-phospho-L-(or D)serine --> L-(or D)serine + phosphate (according to UniProt)
  • [SW|Domains]

  • [SW|PPM-type phosphatase domain] (aa 11-198) (according to UniProt)
  • Structure

  • [PDB|3W42], [PDB|3W43] [Pubmed|26057679]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002610], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|20454630], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab



  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • BKE04740 ([gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCGTTTTCTTCAACCTGGA, downstream forward: _UP4_TAAAAAACCAGAAAAAGAAG
  • BKK04740 ([gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCGTTTTCTTCAACCTGGA, downstream forward: _UP4_TAAAAAACCAGAAAAAGAAG
  • labs

  • [SW|Bill Haldenwang], San Antonio, USA
  • [SW|Chet Price], Davis, USA [ homepage]
  • References


  • 33042030
  • Original publications

  • 8002610,8682769,9658013,8002609,10671474,9068644,19923733,11544224,15466036,8824586,23407164,23320651,21362065,26057679