SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional pleiotropic regulator ([SW|MerR family]) involved in global nitrogen regulation
12.99 kDa
protein length
110 aa Sequence Blast
gene length
330 bp Sequence Blast
regulation of nitrogen assimilation
transcription activator/ repressor ([SW|MerR family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    1,397,411 → 1,397,743

    The protein

    Protein family

  • [SW|MerR family]
  • Effectors of protein activity

  • feedback-inhibited [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|GlnA] prevents [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA] from DNA binding
  • Structure

  • [PDB|4R22] (the TnrA-DNA complex) [Pubmed|25691471]
  • [ 4S0R] (the [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]-[protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|GlnA] complex) [Pubmed|25691471]
  • [SW|Localization]

  • membrane-associated via [protein|796BD46066B1E6147048664FA78679B42FA9D628|NrgA]-[protein|EC7C2A0B5A9A30B2FAA0CF9EEB9830CE0E6F2219|NrgB] under conditions of poor nitrogen supply [Pubmed|21435182]
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [PubMed|10671441,16547045], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]: repression, in [regulon|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]) [Pubmed|10671441,16547045]
  • view in new tab

    Biological materials


  • GP252 (in frame deletion), available in the [SW|Stülke] lab
  • BKE13310 (''tnrA''::''ermC'') (available at the [ BGSC] and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP2262 (''tnrA''::''ermC'') (available in [SW|Jörg Stülke]'s lab)
  • 1A851 ( ''tnrA''::''erm''), [Pubmed|8799114], available at [ BGSC]
  • 1A851 ( ''tnrA''::''erm''), [Pubmed|8799114], available at [ BGSC]
  • BKE13310 (Δ[gene|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCCACCCCTGGATG, downstream forward: _UP4_TAAATAATAAAAGTCCGGCT
  • BKK13310 (Δ[gene|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCCACCCCTGGATG, downstream forward: _UP4_TAAATAATAAAAGTCCGGCT
  • Expression vectors

  • for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP171 available in [SW|Stülke] lab
  • pGP229 (N-terminal Strep-tag, for [SW|SPINE], expression in ''B. subtilis'', in [SW|pGP380]), available in [SW|Stülke] lab
  • Antibody

  • available in the [SW|Karl Forchhammer] lab
  • labs

  • [SW|Susan Fisher], Boston, USA [ homepage]
  • [SW|Maria Schumacher], Durham, NC, USA [ homepage]
  • References


  • 22625175,10231480,18086213
  • The [SW|TnrA regulon]

  • 12823818,25755103
  • Control of TnrA activity by the [SW|trigger enzymes|trigger enzyme] [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|GlnA]

  • 11719184,12139611,17085574,19233925,16885465,26635369
  • Other original publications

  • 12374841,9287005,12950915,10671441,16547045,8799114,15150225,11029411,17001076,15547269,2573733,8636055,16493705,6141156,18667567,21435182,23535029,23808168,25157083,25691471
  • [Pubmed|]