SubtiBank SubtiBank
tnrA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tnrA

transcriptional pleiotropic regulator ([SW|MerR family]) involved in global nitrogen regulation
locus
BSU13310
pI
10.23
mw
12.99 kDa
protein length
110 aa Sequence Blast
gene length
333 bp Sequence Blast
function
regulation of nitrogen assimilation
product
transcription activator/ repressor ([SW|MerR family])
essential
no
synonyms
scgR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.1|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    Coordinates
    1,397,411 1,397,743

    The protein

    Protein family

  • [SW|MerR family]
  • Effectors of protein activity

  • feedback-inhibited [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|GlnA] prevents [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA] from DNA binding
  • Structure

  • [PDB|4R22] (the TnrA-DNA complex) [Pubmed|25691471]
  • [http://pdb.org/pdb/search/structidSearch.do?structureId=4s0r 4S0R] (the [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]-[protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|GlnA] complex) [Pubmed|25691471]
  • [SW|Localization]

  • membrane-associated via [protein|796BD46066B1E6147048664FA78679B42FA9D628|NrgA]-[protein|EC7C2A0B5A9A30B2FAA0CF9EEB9830CE0E6F2219|NrgB] under conditions of poor nitrogen supply [Pubmed|21435182]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000026 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [PubMed|10671441,16547045], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]: repression, in [regulon|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]) [Pubmed|10671441,16547045]
  • view in new tab

    Biological materials

    Mutant

  • GP252 (in frame deletion), available in [SW|Jörg Stülke]'s lab
  • BKE13310 (''tnrA''::''ermC'') (available at the [http://www.bgsc.org/ BGSC] and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP2262 (''tnrA''::''ermC'') (available in [SW|Jörg Stülke]'s lab)
  • 1A851 ( ''tnrA''::''erm''), [Pubmed|8799114], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A851&Search=1A851 BGSC]
  • 1A851 ( ''tnrA''::''erm''), [Pubmed|8799114], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A851&Search=1A851 BGSC]
  • BKE13310 ([gene|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCCACCCCTGGATG, downstream forward: _UP4_TAAATAATAAAAGTCCGGCT
  • BKK13310 ([gene|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCCACCCCTGGATG, downstream forward: _UP4_TAAATAATAAAAGTCCGGCT
  • Expression vectors

  • for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP171 available in [SW|Jörg Stülke]'s lab
  • pGP229 (N-terminal Strep-tag, for [SW|SPINE], expression in ''B. subtilis'', in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in the [SW|Karl Forchhammer] lab
  • labs

  • [SW|Susan Fisher], Boston, USA [http://www.bumc.bu.edu/microbiology/research/susan-h-fisher-phd/ homepage]
  • [SW|Maria Schumacher], Durham, NC, USA [http://www.dukeschumacherlab.com/index.html homepage]
  • References

    Reviews

  • 22625175,10231480,18086213
  • The [SW|TnrA regulon]

  • 12823818,25755103
  • Control of TnrA activity by the [SW|trigger enzymes|trigger enzyme] [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|GlnA]

  • 11719184,12139611,17085574,19233925,16885465,26635369
  • Other original publications

  • 12374841,9287005,12950915,10671441,16547045,8799114,15150225,11029411,17001076,15547269,2573733,8636055,16493705,6141156,18667567,21435182,23535029,23808168,25157083,25691471
  • [Pubmed|]