SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


D-alanine carrier protein, alanylation of teichoic acid provides some resistance against positively charged antimicrobial peptides
8.87 kDa
protein length
gene length
234 bp Sequence Blast
biosynthesis of teichoic acid
D-alanine carrier protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of teichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of teichoic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    3,954,987 → 3,955,223

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + D-alanine + poly(ribitol phosphate) = AMP + diphosphate + O-D-alanyl-poly(ribitol phosphate) (according to Swiss-Prot)
  • Modification

  • modified with the 4′-phosphopantetheine (Ppant) group at Ser35, by [protein|200BE4802FCE3C860565B374EAADC9C1FEEF3E49|AcpS] [pubmed|30283133], then further modified with a d-alanyl group by [protein|795CD64B65D7CBF26E5F706C7617196CC6FCF864|DltA], through a thioester bond [pubmed|30283133]
  • Structure

  • [PDB|4BPG] [Pubmed|26193422]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|7797557], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|14762009], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, [Pubmed|21926231], in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulatory mechanism

  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|7797557], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • expression is reduced in a [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV] mutant [Pubmed|21926231]
  • the mRNA is processed between [gene|459ED28A98F4EC7E8A9016C742DC8EB5C26B5E65|ywzH] and [gene|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials


  • BKE38520 (Δ[gene|862D977CF1E185597329A1EF0915485F72482A03|dltC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAATCCATAGCTTTCTAAT, downstream forward: _UP4_AATCAGCTGTCTGAGTTGAA
  • BKK38520 (Δ[gene|862D977CF1E185597329A1EF0915485F72482A03|dltC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAATCCATAGCTTTCTAAT, downstream forward: _UP4_AATCAGCTGTCTGAGTTGAA
  • References


  • 24819367
  • Original publications

  • 14762009,15955059,26193422,7797557,23980836,21856855,21926231,11434765,30283133