SubtiBank SubtiBank
pabC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pabC

aminodeoxychorismate lyase
locus
BSU_00760
pI
6.12
mw
33.36 kDa
protein length
293 aa Sequence Blast
gene length
882 bp Sequence Blast
function
biosynthesis of folate
product
aminodeoxychorismate lyase
essential
no
ec
4.1.3.38
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.5|Biosynthesis of folate]
  • Gene

    Coordinates
    84,874 85,755

    The protein

    Catalyzed reaction/ biological activity

  • 4-amino-4-deoxychorismate --> 4-aminobenzoate + pyruvate (according to UniProt)
  • Protein family

  • [SW|Class-IV pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|4WHX] (from ''B. pseudomallus'', 27% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B189AD3E3D18876E1956763182D835A151727392|pabB]-[gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]-[gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC]-[gene|FA9539CB701BC47FD4E849FBA6D7B201B27C6104|sul]-[gene|AAE44B4F73C7C02F7DB3574B6169E0DE46F4B787|folB]-[gene|D2B189C6292ACE1B25658B407C284E9A683EAE5B|folK]-[gene|F373EBC35805DC551E8AFF6FDC7E43D5587C4700|yazB]-[gene|CE45D56BC413555AF4E7914B5307AD967A358452|yacF]-[gene|24CC89DE55B3C19F80B11D106B9FD241174AE3E4|lysS]
    description
    [Pubmed|9084182]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9084182], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • translation repressed by tryptophan ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|9084182]
  • view in new tab

    additional information

  • the [gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]-[gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC] part of the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • Biological materials

    Mutant

  • BKE00760 ([gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACCGGCCGTTCACATATA, downstream forward: _UP4_ATTCATGAAAAGGGAGGAAG
  • BKK00760 ([gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACCGGCCGTTCACATATA, downstream forward: _UP4_ATTCATGAAAAGGGAGGAAG
  • References

  • 9084182,21815947