SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


aminodeoxychorismate lyase
33.36 kDa
protein length
293 aa Sequence Blast
gene length
882 bp Sequence Blast
biosynthesis of folate
aminodeoxychorismate lyase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of folate]
  • Gene

    84,874 85,755

    The protein

    Catalyzed reaction/ biological activity

  • 4-amino-4-deoxychorismate --> 4-aminobenzoate + pyruvate (according to UniProt)
  • Protein family

  • [SW|Class-IV pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|4WHX] (from ''B. pseudomallus'', 27% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9084182], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • translation repressed by tryptophan ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|9084182]
  • view in new tab

    additional information

  • the [gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]-[gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC] part of the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • Biological materials


  • BKE00760 ([gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACCGGCCGTTCACATATA, downstream forward: _UP4_ATTCATGAAAAGGGAGGAAG
  • BKK00760 ([gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACCGGCCGTTCACATATA, downstream forward: _UP4_ATTCATGAAAAGGGAGGAAG
  • References

  • 9084182,21815947