SubtiBank SubtiBank
bsdD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

bsdD

phenolic acid decarboxylase, reversible nonoxidative vanillate/4-hydroxybenzoate decarboxylase subunit
locus
BSU_03651
pI
5.00
mw
8.00 kDa
protein length
gene length
228 bp Sequence Blast
function
resistance to salicylic acid
product
phenolic acid decarboxylase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    Coordinates
    414,595 414,822

    The protein

    Catalyzed reaction/ biological activity

  • conversion of vanillic acid to guaiacol [Pubmed|26658822]
  • Expression and Regulation

    Operons

    genes
    [gene|8A83E44AFE9A1A635C65E6B526690AF7DA201BE1|bsdB]-[gene|FD23F4C2AFCBFE35A79116C5A707FACD454E4180|bsdC]-[gene|868DC9DE1C9C26C780F4CEAA4185640B5B6B781B|bsdD]
    description
    [Pubmed|17295427]

    regulatory mechanism

  • [protein|28D03575FA24525C162E6C161631034568E89622|BsdA]: activation, [Pubmed|17295427], in [regulon|28D03575FA24525C162E6C161631034568E89622|BsdA regulon]
  • regulation

  • induced by salicylic acid ([protein|search|BsdA]) [Pubmed|17295427]
  • view in new tab

    Biological materials

    Mutant

  • BKE03651 ([gene|868DC9DE1C9C26C780F4CEAA4185640B5B6B781B|bsdD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03651 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTATGCATTTCGAACATCC, downstream forward: _UP4_CCGGCGGTGCCGGAACGAAA
  • BKK03651 ([gene|868DC9DE1C9C26C780F4CEAA4185640B5B6B781B|bsdD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03651 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTATGCATTTCGAACATCC, downstream forward: _UP4_CCGGCGGTGCCGGAACGAAA
  • References

  • 15979273,17295427,18388975,26658822