SubtiBank SubtiBank
spo0M
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

spo0M

sporulation-control gene
locus
BSU_08760
pI
4.28
mw
29.56 kDa
protein length
258 aa Sequence Blast
gene length
777 bp Sequence Blast
function
sporulation
product
unknown
essential
no
synonyms
ygaI

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    953,373 954,149

    Phenotypes of a mutant

  • Blocked at stage zero of [SW|sporulation] and is susceptible to lysis during vegetative growth [Pubmed|9795118]
  • The protein

    Protein family

  • spo0M family (single member, according to UniProt)
  • Effectors of protein activity

  • the protein is degraded by the [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH] metalloprotease [Pubmed|22142536]
  • Structure

  • [PDB|5CL2] [Pubmed|26625291]
  • [SW|Localization]

  • scattered distribution pattern in cells, appearing near the cell poles and the septum region [pubmed|28234965]
  • Expression and Regulation

    Operons

    genes
    [gene|86BEE9B4DEA83B3B8EFC52EFDDC1F62314FC4291|spo0M]
    description
    [Pubmed|9795118]

    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|9795118], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • additional information

  • the protein is degraded by the [protein|search|FtsH] metalloprotease [PubMed|22142536]
  • view in new tab

    Biological materials

    Mutant

  • BKE08760 ([gene|86BEE9B4DEA83B3B8EFC52EFDDC1F62314FC4291|spo0M]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTAGATCTTCCCCTTT, downstream forward: _UP4_TAAGTATAAAAAGGAGCCGA
  • BKK08760 ([gene|86BEE9B4DEA83B3B8EFC52EFDDC1F62314FC4291|spo0M]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTAGATCTTCCCCTTT, downstream forward: _UP4_TAAGTATAAAAAGGAGCCGA
  • References

    Reviews

  • 28577219
  • Original publications

  • 9795118,11866510,22142536,26625291,28234965