SubtiBank SubtiBank
capB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

capB

part of the [protein|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|CapB]-[protein|D66994D077D1382B88FF65075E44C2A31089548F|CapC] glutmic acid ligase, capsular polyglutamate biosynthesis
locus
BSU_35900
pI
5.07
mw
43.79 kDa
protein length
393 aa Sequence Blast
gene length
1182 bp Sequence Blast
function
capsule synthesis
product
poly-gamma-glutamate synthetase
essential
no
synonyms
ywsC,pgsB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
  • Gene

    Coordinates
    3,699,446 3,700,627

    Phenotypes of a mutant

  • no synthesis of the poly-gamma-glutamate capsule [Pubmed|11751809]
  • The protein

    Catalyzed reaction/ biological activity

  • synthesis of poly-gamma-glutamate from L-Glu [Pubmed|11751809]
  • Expression and Regulation

    Operons

    genes
    [gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]
    description
    [Pubmed|11751809]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19420703], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|19734658], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • additional information

  • expression of the operon is increased in '[protein|search|motA]' or '[protein|search|motB]' mutants due to increased [protein|search|DegU] phosphorylation [PubMed|24296669]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B262 (ywsC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1261 NBRP B. subtilis, Japan]
  • BKE35900 ([gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTCGACATCTCC, downstream forward: _UP4_GTAAGCTAGGGGGAAATGCA
  • BKK35900 ([gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTCGACATCTCC, downstream forward: _UP4_GTAAGCTAGGGGGAAATGCA
  • References

    Reviews

  • 20735481,16689787,29215550
  • Original publications

  • 11751809,19420703,19389763,16233197,19734658,20564357,20564574,24296669,21965392,27073802,29971620,30295732,31837088,16278834