SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


capsular polyglutamate biosynthesis
43.79 kDa
protein length
393 aa Sequence Blast
gene length
1182 bp Sequence Blast
capsule synthesis
poly-gamma-glutamate synthetase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
  • Gene

    3,699,446 3,700,627

    Phenotypes of a mutant

  • no synthesis of the poly-gamma-glutamate capsule [Pubmed|11751809]
  • The protein

    Catalyzed reaction/ biological activity

  • synthesis of poly-gamma-glutamate from L-Glu [Pubmed|11751809]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19420703], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|19734658], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • additional information

  • expression of the operon is increased in '[protein|search|motA]' or '[protein|search|motB]' mutants due to increased [protein|search|DegU] phosphorylation [PubMed|24296669]
  • view in new tab

    Biological materials


  • MGNA-B262 (ywsC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35900 ([gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTCGACATCTCC, downstream forward: _UP4_GTAAGCTAGGGGGAAATGCA
  • BKK35900 ([gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTCGACATCTCC, downstream forward: _UP4_GTAAGCTAGGGGGAAATGCA
  • References


  • 20735481,16689787,29215550
  • Original publications

  • 11751809,19420703,19389763,16233197,19734658,20564357,20564574,24296669,21965392,27073802,29971620,30295732