SubtiBank SubtiBank
yjbH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yjbH

adaptor protein for [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|ClpX]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]-catalyzed [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] degradation, confers resistance against nitrosating agents
locus
BSU_11550
pI
5.21
mw
31.33 kDa
protein length
299 aa Sequence Blast
gene length
900 bp Sequence Blast
function
stimulation of [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] degradation
product
adaptor protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    Coordinates
    1,233,614 1,234,513

    Phenotypes of a mutant

  • increased thermotolerance due to increased stabiliy of [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] and thus increased expression of ''[gene|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|trxA]'' [Pubmed|24417481]
  • The protein

    Catalyzed reaction/ biological activity

  • adaptor protein for [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|ClpX]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]-catalyzed [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] degradation [Pubmed|19074380]
  • Protein family

  • UPF0413 family (single member, according to UniProt)
  • [SW|Cofactors]

  • contains Zn atoms (coordinated by the N-terminal His-rich region) [Pubmed|19074380]
  • Effectors of protein activity

  • [protein|87124945A1CBF7990856FBEB9EAD25096DAC0868|YjbH] aggregates under stress conditions, resulting in the inability to bind to [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx], and therefore in stabilization of [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] [Pubmed|25353645]
  • Zn atom is released upon treatment with strong oxidants [Pubmed|19074380]
  • interaction with [protein|5EC57A51EF2DC48070615653B7A3C1007CFEE01D|YirB] inhibits the formation of a complex with [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] [Pubmed|21378193]
  • Structure

  • [PDB|6GHB] (oxidized Geobacillus kaustophilus protein complexed with B. subtilis Spx) [Pubmed|30982633]
  • [PDB|6GHO] (Geobacillus kaustophilus protein complexed with B. subtilis Spx) [Pubmed|30982633]
  • [SW|Localization]

  • cytosolic protein
  • Expression and Regulation

    Operons

    genes
    [gene|948BD57CC45915C7CDDB8EF168287533FC514B7C|yjbI]-[gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]
    description
    [Pubmed|17293416]

    regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|29271514], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by cell wall stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|29271514]
  • additional information

  • A [protein|search|ncRNA] is predicted between [gene|138DC46C976BAA18893B70DF040BA1BB2FA0A77C|yizD] and [gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH] [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • GP2645 ([gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]::''erm''), available in [SW|Jörg Stülke]'s lab
  • BKE11550 (''[gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE11550 ([gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTATAGCTCATGCTGATAGT, downstream forward: _UP4_TAGCCGCAGGCGTGCATATG
  • BKK11550 ([gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTATAGCTCATGCTGATAGT, downstream forward: _UP4_TAGCCGCAGGCGTGCATATG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Peter Zuber], Oregon Health and Science University, USA
  • [http://www.ogi.edu/people/dsp_person.cfm?person_id=411D6801-2A56-D16D-58A06B4480EDB9C7 Homepage]
  • [SW|Claes von Wachenfeldt], Lund University, Sweden [http://aron.ldc.lu.se/kundwebb/cellorg/mibiol/research/wachen/index.htm Homepage]
  • References

    Reviews

  • 23375660,23479438,19609260,28748186
  • Original Publications

  • 17293416,19074380,17908206,20525796,21378193,21947404,24417481,24942655,25353645,27191337,29271514,30982633