SubtiBank SubtiBank
ydzK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydzK

unknown
locus
BSU_04359
pI
10.23
mw
9.60 kDa
protein length
gene length
267 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    490,777 491,043

    Expression and Regulation

    Operons

    genes
    [gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]

    description

  • [pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04359 ([gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04359 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCAAAACTCCGATTT, downstream forward: _UP4_TAACCTATTATGAGAAGAGT
  • BKK04359 ([gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04359 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCAAAACTCCGATTT, downstream forward: _UP4_TAACCTATTATGAGAAGAGT