SubtiBank SubtiBank
thiO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

thiO

FAD-dependent glycine oxidase
locus
BSU_11670
pI
5.90
mw
40.78 kDa
protein length
369 aa Sequence Blast
gene length
1110 bp Sequence Blast
function
biosynthesis of thiamine
product
glycine oxidase
essential
no
ec
1.4.3.19
synonyms
goxB,yjbR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.3|Biosynthesis/ acquisition of thiamine]
  • Gene

    Coordinates
    1,243,735 1,244,844

    The protein

    Catalyzed reaction/ biological activity

  • glycine + H2O + O2 --> glyoxylate + H2O2 + NH4+ (according to UniProt)
  • H2O + N-ethylglycine + O2 --> ethylamine + glyoxylate + H2O2 (according to UniProt)
  • H2O + O2 + sarcosine --> glyoxylate + H2O2 + methylamine (according to UniProt)
  • D-alanine + H2O + O2 --> H2O2 + NH4+ + pyruvate (according to UniProt)
  • glyphosate + H2O + O2 --> aminomethylphosphonate + glyoxylate + H+ + H2O2 (according to UniProt)
  • Protein family

  • DAO family (single member, according to UniProt)
  • Modification

  • FAD [Pubmed|19751796]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|1NG3] (complex with acetyl-glycine), [PDB|1RYI]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]-[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]-[gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]-[gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]-[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]-[gene|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|thiF]-[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]
    description
    [Pubmed|1898926]

    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], via [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([SW|Thi-box]) [Pubmed|16356850]
  • the [SW|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B164 (yjbR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1163 NBRP B. subtilis, Japan]
  • BKE11670 ([gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTCCGCCTCCAATCACCA, downstream forward: _UP4_CGCAAGGAGGCGGTTCAGAT
  • BKK11670 ([gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTCCGCCTCCAATCACCA, downstream forward: _UP4_CGCAAGGAGGCGGTTCAGAT
  • References

    Reviews

  • 19348578,10382260
  • Original publications

  • 19254749,11744710,12654003,9827558,12627963,15105420,19751796,19864430,14567704,20690620,24925096,31562850