SubtiBank SubtiBank
spoIVFB
The papers of the month are back! Check them out! Link here

spoIVFB

intramembrane metalloprotease, processing of pro-sigma-K to active [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN]
locus
BSU27970
pI
8.48
mw
33.49 kDa
protein length
288 aa Sequence Blast
gene length
864 bp Sequence Blast
function
processing of pro-sigma-K to active [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN]
product
intramembrane metalloprotease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.3|Proteolysis during sporulation/ germination]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,855,973 → 2,856,839

    The protein

    Catalyzed reaction/ biological activity

  • processing of pro-sigma-K to active [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN] [Pubmed|19805276]
  • Protein family

  • peptidase M50B family (according to Swiss-Prot)
  • [SW|Domains]

  • C-terminal [SW|CBS domain], this domain binds ATP [Pubmed|19805276]
  • Effectors of protein activity

  • ATP regulates substrate access to the active site and renders cleavage sensitive to the cellular energy level [Pubmed|19805276]
  • [SW|Localization]

  • integral membrane protein [Pubmed|11959848]
  • mother cell membrane [Pubmed|24243021]
  • Expression and Regulation

    Operons

    genes
    [gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]-[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]
    description
    [Pubmed|1942049]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,1942049], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,1942049,15383836]
  • additional information

  • the domains that inhibits [protein|search|SpoIVFB] is cleaved off by [protein|search|CtpB] (second cleavage) [PubMed|24243021]
  • view in new tab

    genes
    [gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]-[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]-[gene|11927EB0448839D047EC7BF70EC65156DAB481D3|rplU]-[gene|B27548A4BBF396C9BA102A80ACB08B21262CEA30|prp]-[gene|4626C659D6F1A81CCC94030F1CBAF7FEC3DE19CA|rpmA]
    description
    [Pubmed|22383849]

    regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,1942049,15383836]
  • additional information

  • the domains that inhibits [protein|search|SpoIVFB] is cleaved off by [protein|search|CtpB] (second cleavage) [PubMed|24243021]
  • view in new tab

    Biological materials

    Mutant

  • BKE27970 (Δ[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATCTTTAAGATAAGGTCGA, downstream forward: _UP4_TAAAACTGATTGACAAACGC
  • BKK27970 (Δ[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATCTTTAAGATAAGGTCGA, downstream forward: _UP4_TAAAACTGATTGACAAACGC
  • References

    Reviews

  • 20836086,23479438,19189971,24099006
  • Original Publications

  • 11959848,9501233,12940997,1577688,12060714,9078383,1942049,10611287,15383836,16818230,19805276,15699190,23585539,23995631,15087499,24243021,22383849,26953342,29180425