SubtiBank SubtiBank
yvkN
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvkN

unknown
locus
BSU_35140
pI
5.83
mw
8.80 kDa
protein length
gene length
231 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,608,991 3,609,221

    Expression and Regulation

    Operons

    genes
    [gene|882FB98B963D49A8A4F6DE60C328BF8F6ECF158E|yvkN]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A350 (yvkN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/350 NBRP B. subtilis, Japan]
  • BKE35140 ([gene|882FB98B963D49A8A4F6DE60C328BF8F6ECF158E|yvkN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTGTCCAGCCTCCT, downstream forward: _UP4_TAATTGCGGAAAACATATCA
  • BKK35140 ([gene|882FB98B963D49A8A4F6DE60C328BF8F6ECF158E|yvkN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTGTCCAGCCTCCT, downstream forward: _UP4_TAATTGCGGAAAACATATCA