SubtiBank SubtiBank
salA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

salA

negative regulator of [gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC] expression, activator of [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA] kinase activity
locus
BSU_01540
pI
5.23
mw
38.48 kDa
protein length
352 aa Sequence Blast
gene length
1059 bp Sequence Blast
function
control of alkaline protease expression
product
MRP family regulator
essential
no
synonyms
ybaL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.6|Transition state regulators]
  • Gene

    Coordinates
    157,421 158,479

    Phenotypes of a mutant

  • increased expression of ''[gene|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE]'' (due to loss of repression of ''[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]'' expression)
  • The protein

    Catalyzed reaction/ biological activity

  • transcription repression of ''[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]'' expression [SW|26094643]
  • Protein family

  • Mrp/NBP35 ATP-binding proteins family (single member, according to UniProt)
  • [SW|Domains]

  • DNA-binding domain: aa 1 - 60 [Pubmed|26094643]
  • ATP-binding Walker domain: aa 105 - 275 [Pubmed|26094643]
  • domain for the interaction with [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA]: aa 294 - 352
  • Modification

  • [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA]-dependent phosphorylation at Tyr-327 results in better binding of the target promoter [Pubmed|26094643]
  • Structure

  • [PDB|4V03] (MinD from Aquifex aeolicus, corresponds to C-terminal domain, aa 109 ... 344, 28% identity) [pubmed|25500731]
  • Expression and Regulation

    Operons

    genes
    [gene|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|SalA]: repression, in [regulon|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|SalA regulon]
  • view in new tab

    Biological materials

    Mutant

  • 1A919 ( ''salA''::''erm''), [Pubmed|15126467], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A919&Search=1A919 BGSC]
  • BKE01540 ([gene|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAACCTCACCCTTTTG, downstream forward: _UP4_TAAAAGGTGAACCGGGATTC
  • BKK01540 ([gene|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAACCTCACCCTTTTG, downstream forward: _UP4_TAAAAGGTGAACCGGGATTC
  • References

  • 15126467,26286503,26094643,27725816,25500731