SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


negative regulator of scoC expression, activator of PtkA kinase activity
38.48 kDa
protein length
352 aa Sequence Blast
gene length
1056 bp Sequence Blast
control of alkaline protease expression
MRP family regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.6|Transition state regulators]
  • Gene

    157,421 → 158,479

    Phenotypes of a mutant

  • increased expression of ''[gene|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE]'' (due to loss of repression of ''[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]'' expression)
  • The protein

    Catalyzed reaction/ biological activity

  • transcription repression of ''[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]'' expression [SW|26094643]
  • Protein family

  • Mrp/NBP35 ATP-binding proteins family (according to Swiss-Prot)
  • [SW|Domains]

  • DNA-binding domain: aa 1 - 60 [Pubmed|26094643]
  • ATP-binding Walker domain: aa 105 - 275 [Pubmed|26094643]
  • domain for the interaction with [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA]: aa 294 - 352
  • Modification

  • [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA]-dependent phosphorylation at Tyr-327 results in better binding of the target promoter [Pubmed|26094643]
  • Expression and Regulation



    regulatory mechanism

  • [protein|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|SalA]: repression, in [regulon|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|SalA regulon]
  • view in new tab

    Biological materials


  • 1A919 ( ''salA''::''erm''), [Pubmed|15126467], available at [ BGSC]
  • BKE01540 (Δ[gene|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAACCTCACCCTTTTG, downstream forward: _UP4_TAAAAGGTGAACCGGGATTC
  • BKK01540 (Δ[gene|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|salA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAACCTCACCCTTTTG, downstream forward: _UP4_TAAAAGGTGAACCGGGATTC
  • References

  • 15126467,26286503,26094643,27725816