SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


response regulator aspartate phosphatase ([protein|C8BF3815578293542D14811C60F4CA78AACF73EB|RapK]) regulator, controls [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] activity
3.98 kDa
protein length
gene length
123 bp Sequence Blast
control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] activity
phosphatase ([protein|C8BF3815578293542D14811C60F4CA78AACF73EB|RapK]) regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Control of response regulators/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.8|Short peptides]
  • Gene

    2,063,262 2,063,384

    The protein

    Catalyzed reaction/ biological activity

  • inhibits [protein|C8BF3815578293542D14811C60F4CA78AACF73EB|RapK] activity [Pubmed|16816200]
  • Protein family

  • [SW|phr family] (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|11466295], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|25666134], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|25666134]
  • view in new tab

    Biological materials


  • BKE18920 ([gene|886C1BAE024A9D1A6C7C4F16E5251D5427B8D41E|phrK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATAAGATTCCCTCCAC, downstream forward: _UP4_TAAAAAAGGTTGATTAATTA
  • BKK18920 ([gene|886C1BAE024A9D1A6C7C4F16E5251D5427B8D41E|phrK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATAAGATTCCCTCCAC, downstream forward: _UP4_TAAAAAAGGTTGATTAATTA
  • References

  • 11466295,16816200,20817675