SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


30.89 kDa
protein length
269 aa Sequence Blast
gene length
810 bp Sequence Blast
maybe involved in iron homeostasis

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|Acquisition of iron / Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    3,053,364 3,054,173

    Phenotypes of a mutant

  • derepression of the [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur] and [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR] regulons [Pubmed|21949854]
  • elevated oxidative protein damage upon exposure of the cells to methylglyoxal [Pubmed|21949854]
  • the ''[gene|2C6386E9A63F410558D168798D077DF91590F454|spx] [gene|886EF2F8A9E031FDF919E01A858C1DBC1AFF1188|ytpQ]'' doulbe mutant shows reduced growth in minimal medium and hypersensitivity to methylglyoxal [Pubmed|21949854]
  • The protein

    Protein family

  • UPF0354 family (single member, according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21949854], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|21949854], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    Biological materials


  • MGNA-A437 (ytpQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29830 ([gene|886EF2F8A9E031FDF919E01A858C1DBC1AFF1188|ytpQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCAAACCGATGTCCT, downstream forward: _UP4_AAGGATTAGAAAGGATTTTT
  • BKK29830 ([gene|886EF2F8A9E031FDF919E01A858C1DBC1AFF1188|ytpQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCAAACCGATGTCCT, downstream forward: _UP4_AAGGATTAGAAAGGATTTTT
  • References

  • 21949854