SubtiBank SubtiBank
yhaP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhaP

similar to [SW|ABC transporter] (membrane protein)
locus
BSU_09900
pI
5.31
mw
45.27 kDa
protein length
419 aa Sequence Blast
gene length
1260 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (membrane protein)
essential
no
synonyms
natB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.6|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,063,480 1,064,739

    The protein

    [SW|Localization]

  • cell membrane (Septum) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|C1FE13182E3E62EBC9650B02DAA0D574332A5F4D|yhaQ]-[gene|887036DE96BD6174EAC2E7201BEEDE99E45EDDF0|yhaP]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675,18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logarithmic phase ([protein|search|AbrB]) [Pubmed|18840696]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C045 (natB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2043 NBRP B. subtilis, Japan]
  • BKE09900 ([gene|887036DE96BD6174EAC2E7201BEEDE99E45EDDF0|yhaP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTATGAGAAAGCATGATCC, downstream forward: _UP4_TGATTGGAAAACAGCCTGGG
  • BKK09900 ([gene|887036DE96BD6174EAC2E7201BEEDE99E45EDDF0|yhaP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTATGAGAAAGCATGATCC, downstream forward: _UP4_TGATTGGAAAACAGCCTGGG
  • References

  • 10092453,18840696,16479537,21630458,20817675