SubtiBank SubtiBank
yddR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yddR

similar to isothiocyanate hydrolase
locus
BSU_05080
pI
5.12
mw
28.35 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    553,711 554,475

    The protein

    Protein family

  • UPF0173 family (with [protein|8B28AA1A88FA56C9F4742F668B28F3323715D948|YtkL], according to UniProt)
  • Structure

  • [PDB|6BRM] (46% identity)
  • Biological materials

    Mutant

  • MGNA-C126 (yddR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2124 NBRP B. subtilis, Japan]
  • BKE05080 ([gene|888BC7D4C610DEBA6D46638F5FA1E86C1D433F48|yddR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTACAACTCACTTTC, downstream forward: _UP4_TAATATGAACACCGACAAAT
  • BKK05080 ([gene|888BC7D4C610DEBA6D46638F5FA1E86C1D433F48|yddR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTACAACTCACTTTC, downstream forward: _UP4_TAATATGAACACCGACAAAT
  • References

  • 20525796