SubtiBank SubtiBank
pdaA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

pdaA

N-acetylmuramic acid deacetylase, spore cortex peptidoglycan synthesis
locus
BSU_07980
pI
7.32
mw
29.92 kDa
protein length
263 aa Sequence Blast
gene length
792 bp Sequence Blast
function
spore cortex peptidoglycan synthesis
product
N-acetylmuramic acid deacetylase
essential
no
synonyms
yfjS

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    869,559 870,350

    The protein

    Catalyzed reaction/ biological activity

  • de-N-acetylation of N-acetylglucosamine and N-acetyl-muramic acid for spore cortex peptidoglycan [Pubmed|15687192]
  • Protein family

  • [SW|polysaccharide deacetylase family] (according to UniProt)
  • [SW|Domains]

  • [SW|NodB homology domain] (aa 66-247) (according to UniProt)
  • Structure

  • [PDB|1W17] [pubmed|15251431]
  • Expression and Regulation

    Operons

    genes
    [gene|88E167795BBCB8529E322E3A4DC9965EA6AAA617|pdaA]
    description
    [Pubmed|12374835]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|12374835,15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|12374835,15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C273 (yfjS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2271 NBRP B. subtilis, Japan]
  • BKE07980 ([gene|88E167795BBCB8529E322E3A4DC9965EA6AAA617|pdaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCCAGCGCTCCTTCTG, downstream forward: _UP4_TAAAAGAGAAAGACCTCTCC
  • BKK07980 ([gene|88E167795BBCB8529E322E3A4DC9965EA6AAA617|pdaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCCAGCGCTCCTTCTG, downstream forward: _UP4_TAAAAGAGAAAGACCTCTCC
  • References

  • 12374835,15687192,15699190,15251431,14679227,24405365