SubtiBank SubtiBank
yusD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yusD

unknown
locus
BSU_32760
pI
5.45
mw
12.72 kDa
protein length
114 aa Sequence Blast
gene length
345 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,364,618 3,364,962

    The protein

    [SW|Domains]

  • SCP2 domain (aa 21-101) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|2122B0B9C3CB9488285ABDAEA451B45CD310268C|yusE]-[gene|8907351A05E7A2717AD6E743F0240FD94723425B|yusD]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/yusED.html DBTBS]) null

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B589 (yusD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1588 NBRP B. subtilis, Japan]
  • BKE32760 ([gene|8907351A05E7A2717AD6E743F0240FD94723425B|yusD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTACAACCTCCTATT, downstream forward: _UP4_TAAAAAATAATAAATTATTA
  • BKK32760 ([gene|8907351A05E7A2717AD6E743F0240FD94723425B|yusD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTACAACCTCCTATT, downstream forward: _UP4_TAAAAAATAATAAATTATTA
  • References

  • 14651647