SubtiBank SubtiBank
comZ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

comZ

late competence gene
locus
BSU_11310
pI
4.37
mw
7.08 kDa
protein length
gene length
192 bp Sequence Blast
function
compentence
product
unknown
essential
no
synonyms
yjzA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    1,207,597 1,207,788

    Expression and Regulation

    Operons

    genes
    [gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|D08B0A131374D2949ABC3EF8D6117C6BC6D94FE5|yjaV]-[gene|4DAB7847EA3848A34432C80124464543FA3DCA0F|med]-[gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    genes
    [gene|4DAB7847EA3848A34432C80124464543FA3DCA0F|med]-[gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]
    description
    [Pubmed|9335269]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9335269], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    genes
    [gene|2BF1CA62F5B8B54A25B70721D39B5BD38C0203EB|yjaU]-[gene|D08B0A131374D2949ABC3EF8D6117C6BC6D94FE5|yjaV]-[gene|4DAB7847EA3848A34432C80124464543FA3DCA0F|med]-[gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE11310 ([gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTTCGTGCTGCATGTGAC, downstream forward: _UP4_TAAGAAGAAGCCACTTTTTT
  • BKK11310 ([gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTTCGTGCTGCATGTGAC, downstream forward: _UP4_TAAGAAGAAGCCACTTTTTT
  • References

  • 10940045,9335269,14651647