SubtiBank SubtiBank
kdgR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

kdgR

transcriptional repressor of the pectin utilization operon ([SW|LacI family])
locus
BSU_22120
pI
8.82
mw
37.70 kDa
protein length
339 aa Sequence Blast
gene length
1020 bp Sequence Blast
function
regulation of galacturonic acid utilization
product
transcriptional repressor of the pectin utilization operon ([SW|LacI family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.15|Utilization of hexuronate]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    2,324,613 2,325,632

    The protein

    Protein family

  • [SW|LacI family]
  • Structure

  • [PDB|2HSG] (B. megaterium [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA], 26% identity) [pubmed|17500051]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000193 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|891A32A19D1353BA566FF121BBCA7B986D31D129|kdgR]-[gene|8A0BB2BE0AAAA7FF834A4549E8E2AF343FB10571|kdgK]-[gene|826BFCE6ED2113BB0510E798C6CDB05C4665E0E2|kdgA]-[gene|EB6F40F8651654E0AB09447C5AD670C35A59F261|kdgT]
    description
    [Pubmed|9846747]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9846747], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR]: repression, [Pubmed|9846747], in [regulon|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|9846747], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR]) [Pubmed|9846747]
  • view in new tab

    Biological materials

    Mutant

  • BKE22120 ([gene|891A32A19D1353BA566FF121BBCA7B986D31D129|kdgR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAGTGCTCCTGTATC, downstream forward: _UP4_TAATCCTAGGTGCCCTCAAC
  • BKK22120 ([gene|891A32A19D1353BA566FF121BBCA7B986D31D129|kdgR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAGTGCTCCTGTATC, downstream forward: _UP4_TAATCCTAGGTGCCCTCAAC
  • References

  • 17322190,22900538,9846747,17500051