SubtiBank SubtiBank
yfmG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yfmG

unknown
locus
BSU_07480
pI
5.18
mw
56.37 kDa
protein length
487 aa Sequence Blast
gene length
1464 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    820,867 822,330

    The protein

    Modification

  • phosphorylated on Arg-474 [Pubmed|22517742]
  • Structure

  • [PDB|2AFT] (human protein, corresponds to aa 205 ... 467, 25% identity) [pubmed|16368756]
  • Expression and Regulation

    Operons

    genes
    [gene|8A9E5A121CA2C5CE8A7A2DD2FDCE2AD5FCB356BF|yfmH]-[gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]
    description
    [Pubmed|32611709]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|32611709], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|8A9E5A121CA2C5CE8A7A2DD2FDCE2AD5FCB356BF|YfmH]: attenuation, [pubmed|32611709], in [regulon|8A9E5A121CA2C5CE8A7A2DD2FDCE2AD5FCB356BF|YfmH regulon]
  • regulation

  • repressed by glucose (4-fold) [Pubmed|12850135]
  • additional information

  • A [protein|search|ncRNA] is predicted between [gene|3DFC1A118B346C7939851BF711FFA31E04A698E8|yfmI] and [gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG], this has been shown to encode the leader peptide, [protein|8A9E5A121CA2C5CE8A7A2DD2FDCE2AD5FCB356BF|YfmH] [PubMed|32611709,20525796]
  • Expression of [gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG] is controlled by [protein|8A9E5A121CA2C5CE8A7A2DD2FDCE2AD5FCB356BF|YfmH]-mediated attenuation: slow translation rates of [protein|8A9E5A121CA2C5CE8A7A2DD2FDCE2AD5FCB356BF|YfmH] due to amino acid limitation prevent the formation in the [gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG] leader (reduced expression of [gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG] if amino acids are available in excess) [pubmed|32611709]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C243 (yfmG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2241 NBRP B. subtilis, Japan]
  • BKE07480 ([gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTACGATAACCTCCCG, downstream forward: _UP4_TAATCATTCTAGGTTAGAGA
  • BKK07480 ([gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTACGATAACCTCCCG, downstream forward: _UP4_TAATCATTCTAGGTTAGAGA
  • References

  • 22517742,20817675,21815947,12850135,20525796,16368756,32611709