SubtiBank SubtiBank
comGG
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

comGG

DNA transport machinery, minor pseudopilin
locus
BSU_24670
pI
9.19
mw
14.40 kDa
protein length
124 aa Sequence Blast
gene length
375 bp Sequence Blast
function
genetic competence, DNA uptake
product
minor pseudopilin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,556,137 2,556,511

    Phenotypes of a mutant

  • loss of [SW|genetic competence] [Pubmed|24164455]
  • The protein

    [SW|Localization]

  • cell surface [Pubmed|9723928]
  • Expression and Regulation

    Operons

    genes
    [gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]-[gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]-[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]-[gene|FF4DB7FDCEB440064E11E65CB0DBFB93FC785CF0|comGE]-[gene|DD266DC0D78B5C5E82EED7CC7F55D0CF8FB4BF7A|comGF]-[gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG]-[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]
    description
    [Pubmed|26735940,2507524]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507524], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|26735940], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|26735940]
  • additional information

  • the ''[SW|comGA]-[SW|comGB]-[SW|comGC]-[SW|comGD]-[SW|comGE]-[SW|comGF]-[SW|comGG]-[protein|search|spoIIIL]'' operon requires [SW|NusA] for expression [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • BKE24670 ([gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATAAACCCTCTTGTACGAT, downstream forward: _UP4_TAAAACAGTGTAAAGGGTAT
  • BKK24670 ([gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATAAACCCTCTTGTACGAT, downstream forward: _UP4_TAAAACAGTGTAAAGGGTAT
  • BP914 (([gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]-[gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]-[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]-[gene|FF4DB7FDCEB440064E11E65CB0DBFB93FC785CF0|comGE]-[gene|DD266DC0D78B5C5E82EED7CC7F55D0CF8FB4BF7A|comGF]-[gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG])::phleo), available in [SW|Fabian Commichau]'s lab
  • References

    Reviews

  • 15083159
  • Original publications

  • 9422590,9723928,11814663,8196543,12107147,2507524,24164455