SubtiBank SubtiBank
kdgK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

kdgK

2-dehydro-3-deoxygluconokinase
locus
BSU_22110
pI
5.68
mw
34.88 kDa
protein length
324 aa Sequence Blast
gene length
975 bp Sequence Blast
function
utilization of galacturonic acid
product
2-dehydro-3-deoxygluconokinase
essential
no
ec
2.7.1.45
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.15|Utilization of hexuronate]
  • Gene

    Coordinates
    2,323,601 2,324,575

    The protein

    Catalyzed reaction/ biological activity

  • 2-dehydro-3-deoxy-D-gluconate + ATP --> 2-dehydro-3-deoxy-6-phospho-D-gluconate + ADP + H+ (according to UniProt)
  • Protein family

  • [SW|carbohydrate kinase PfkB family] (according to UniProt)
  • Structure

  • [PDB|4DU5] (from Polaromonas sp., 49% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|891A32A19D1353BA566FF121BBCA7B986D31D129|kdgR]-[gene|8A0BB2BE0AAAA7FF834A4549E8E2AF343FB10571|kdgK]-[gene|826BFCE6ED2113BB0510E798C6CDB05C4665E0E2|kdgA]-[gene|EB6F40F8651654E0AB09447C5AD670C35A59F261|kdgT]
    description
    [Pubmed|9846747]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9846747], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR]: repression, [Pubmed|9846747], in [regulon|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|9846747], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR]) [Pubmed|9846747]
  • view in new tab

    Biological materials

    Mutant

  • BKE22110 ([gene|8A0BB2BE0AAAA7FF834A4549E8E2AF343FB10571|kdgK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTCCCAACCTCCTC, downstream forward: _UP4_CACCAAAAGAAAGGGGATTA
  • BKK22110 ([gene|8A0BB2BE0AAAA7FF834A4549E8E2AF343FB10571|kdgK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTCCCAACCTCCTC, downstream forward: _UP4_CACCAAAAGAAAGGGGATTA
  • References

  • 9846747