SubtiBank SubtiBank
ysgA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ysgA

similar to rRNA methylase
locus
BSU_28650
pI
5.18
mw
26.75 kDa
protein length
248 aa Sequence Blast
gene length
747 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
2.1.1.-
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.2|rRNA modification and maturation]
  • Gene

    Coordinates
    2,930,827 2,931,573

    Phenotypes of a mutant

  • essential [Pubmed|17114254], non-essential according to [Pubmed|28189581]
  • The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • class IV-like SAM-binding methyltransferase superfamily (with [protein|8CB595F84D00D1262EB13E6CF47BE6F00EDE16A5|YacO] and [protein|03BA7AEE17739689D632A35D9C3329EA0982C98A|CspR], according to UniProt)
  • Paralogous protein(s)

  • [protein|8CB595F84D00D1262EB13E6CF47BE6F00EDE16A5|YacO]
  • [SW|Cofactors]

  • SAM (according to UniProt)
  • Structure

  • [PDB|4X3M]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|8A2898B80D0FFA56C5AA86C6F09D886A62AABBDA|ysgA]
    description
    [Pubmed|8969504]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B006 (ysgA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1005 NBRP B. subtilis, Japan]
  • BKE28650 ([gene|8A2898B80D0FFA56C5AA86C6F09D886A62AABBDA|ysgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTCTATGTGGCGCTCC, downstream forward: _UP4_TAGTGTTGCGCCAAGCGTTG
  • BKK28650 ([gene|8A2898B80D0FFA56C5AA86C6F09D886A62AABBDA|ysgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTCTATGTGGCGCTCC, downstream forward: _UP4_TAGTGTTGCGCCAAGCGTTG
  • References

  • 17114254,8969504,28189581,12077432