SubtiBank SubtiBank
yrkQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrkQ

two-component sensor kinase
locus
BSU_26420
pI
5.16
mw
49.56 kDa
protein length
432 aa Sequence Blast
gene length
1299 bp Sequence Blast
function
unknown
product
two-component sensor kinase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    2,703,150 2,704,448

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • [SW|Domains]

  • two transmembrane segments, C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP]-[gene|8A38FEFAA0FF91D989B77D40CBB3741902DC9D67|yrkQ]-[gene|E0DF6DE230AD0B632EEC0A1FB11EB32E59BD573E|yrkR]
    description
    [Pubmed|18175906]

    regulatory mechanism

  • [protein|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP]: activation, [Pubmed|18175906], in [regulon|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C423 (yrkQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2421 NBRP B. subtilis, Japan]
  • BKE26420 ([gene|8A38FEFAA0FF91D989B77D40CBB3741902DC9D67|yrkQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCCAGTTTTTTGGTTAGCG, downstream forward: _UP4_TAGGCTGAGAATAAAAACCA
  • BKK26420 ([gene|8A38FEFAA0FF91D989B77D40CBB3741902DC9D67|yrkQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCCAGTTTTTTGGTTAGCG, downstream forward: _UP4_TAGGCTGAGAATAAAAACCA
  • References

  • 10094672,18175906