SubtiBank SubtiBank
spsI
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

spsI

glucose-1-phosphate thymidylyltransferase, spore coat polysaccharide synthesis
locus
BSU37840
pI
5.39
mw
27.62 kDa
protein length
246 aa Sequence Blast
gene length
738 bp Sequence Blast
function
rhamnose biosynthesis, spore coat polysaccharide synthesis
product
glucose-1-phosphate thymidylyltransferase
essential
no
ec
2.7.7.24
synonyms
ipa-71d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.7|Biosynthesis of rhamnose (for the exosporium)]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,885,239 → 3,885,979

    The protein

    Catalyzed reaction/ biological activity

  • alpha-D-glucose-1-phosphate dTTP -→ dTDP-glucose [Pubmed|22960854]
  • Protein family

  • glucose-1-phosphate thymidylyltransferase family (according to Swiss-Prot)
  • [SW|Localization]

  • outer spore coat [Pubmed|26577401]
  • Expression and Regulation

    Operons

    genes
    [gene|219B0AAFB4ABB7E97A906553B73423F712505E27|spsA]-[gene|9E577B935FAB9605DAF83353E907A6561F11CAC1|spsB]-[gene|38DBA751456A0C0EC5D028939ADB8860ADA28F94|spsC]-[gene|2648D9E356683F5E9C00C40F0A6BBD1933322B09|spsD]-[gene|F27921CD9B89EB16AA57ACECEDBF21ED383629F0|spsE]-[gene|222F7086A214A427174E188CB1FEE4A8B98D303C|spsF]-[gene|9B34C9DBEC5B84A631CDFBEE8DF44384FF5C03B0|spsG]-[gene|8A80A058F270C134891CBCE7EBD8D7A23797F599|spsI]-[gene|90D505CAA4FAAEB6A6AF5C278E70DF714FACB4DA|spsJ]-[gene|4A4C5E6C1DFD46BC3CF9AEBA3FC1577767FF8465|spsK]-[gene|F87238E9B22F967370971ABA4F911EFAC4F559B5|spsL]
    description
    [Pubmed|9353933]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|26577401], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|25239894,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|26577401,25239894,15383836]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE37840 (Δ[gene|8A80A058F270C134891CBCE7EBD8D7A23797F599|spsI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTAACACTTCCTTACA, downstream forward: _UP4_CGGAAAGGACAGGACGAAAA
  • BKK37840 (Δ[gene|8A80A058F270C134891CBCE7EBD8D7A23797F599|spsI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTAACACTTCCTTACA, downstream forward: _UP4_CGGAAAGGACAGGACGAAAA
  • References

  • 9353933,15383836,12884008,21821766,22960854,25239894,26577401