SubtiBank SubtiBank
bsdB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

bsdB

phenolic acid decarboxylase
locus
BSU_03630
pI
10.06
mw
22.39 kDa
protein length
204 aa Sequence Blast
gene length
615 bp Sequence Blast
function
resistance to salicylic acid
product
phenolic acid decarboxylase
essential
no
synonyms
yclB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    Coordinates
    412,540 413,154

    The protein

    Catalyzed reaction/ biological activity

  • conversion of vanillic acid to guaiacol [Pubmed|26658822]
  • dimethylallyl phosphate + FMNH2 --> phosphate + prenyl-FMNH2 (according to UniProt)
  • Protein family

  • UbiX/PAD1 family (single member, according to UniProt)
  • Structure

  • [PDB|1SBZ] (from E. coli, 57% identity) [pubmed|15459342]
  • Expression and Regulation

    Operons

    genes
    [gene|8A83E44AFE9A1A635C65E6B526690AF7DA201BE1|bsdB]-[gene|FD23F4C2AFCBFE35A79116C5A707FACD454E4180|bsdC]-[gene|868DC9DE1C9C26C780F4CEAA4185640B5B6B781B|bsdD]
    description
    [Pubmed|17295427]

    regulatory mechanism

  • [protein|28D03575FA24525C162E6C161631034568E89622|BsdA]: activation, [Pubmed|17295427], in [regulon|28D03575FA24525C162E6C161631034568E89622|BsdA regulon]
  • regulation

  • induced by salicylic acid ([protein|search|BsdA]) [Pubmed|17295427]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C061 (yclB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2059 NBRP B. subtilis, Japan]
  • BKE03630 ([gene|8A83E44AFE9A1A635C65E6B526690AF7DA201BE1|bsdB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAATCATACTCCTGA, downstream forward: _UP4_AAACAAAAAGGAGGAGCTTG
  • BKK03630 ([gene|8A83E44AFE9A1A635C65E6B526690AF7DA201BE1|bsdB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAATCATACTCCTGA, downstream forward: _UP4_AAACAAAAAGGAGGAGCTTG
  • References

  • 15979273,17295427,26658822,15459342