SubtiBank SubtiBank
fadR
The papers of the month are back! Check them out! Link here

fadR

transcriptional repressor (TetR family), regulation of fatty acid degradation
locus
BSU28550
pI
6.12
mw
21.83 kDa
protein length
194 aa Sequence Blast
gene length
582 bp Sequence Blast
function
regulation of fatty acid degradation
product
transcriptional repressor
essential
no
synonyms
ysiA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.3|Utilization of fatty acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    2,917,957 → 2,918,541

    The protein

    Protein family

  • [SW|TetR family]
  • Effectors of protein activity

  • long chain fatty acids act as inducers that release FadR from its operator sites [Pubmed|24356978]
  • Structure

  • [PDB|3WHB] [pubmed|24356978]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000195 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|7AC5217CA35F8E134ABB35D74F1BA5E684D2E058|lcfA]-[gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]-[gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]-[gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]-[gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]
    description
    [Pubmed|17189250]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21398533], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|21398533], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by long chain acyl-CoA (C14 ... C20) ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]) [Pubmed|17189250]
  • view in new tab

    genes
    [gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]-[gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]-[gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]-[gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]
    description
    [Pubmed|17189250]

    regulation

  • induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B008 (ysiA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1007 NBRP B. subtilis, Japan]
  • 1A853 ( ''fadR''::''cat''), [Pubmed|17085570], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A853&Search=1A853 BGSC]
  • BKE28550 (Δ[gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTTCATCGTTCCTTCC, downstream forward: _UP4_AATAAGTAAAGGAGTTCTGT
  • BKK28550 (Δ[gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTTCATCGTTCCTTCC, downstream forward: _UP4_AATAAGTAAAGGAGTTCTGT
  • References

    Reviews

  • 17919287,24006471
  • Original publications

  • 17189250,21398533,24356978