SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional repressor (TetR family), regulation of fatty acid degradation
21.83 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
regulation of fatty acid degradation
transcriptional repressor

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW|Utilization of fatty acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    2,917,957 2,918,541

    The protein

    Protein family

  • [SW|TetR family]
  • Effectors of protein activity

  • long chain fatty acids act as inducers that release FadR from its operator sites [Pubmed|24356978]
  • Structure

  • [PDB|3WHB] [pubmed|24356978]
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21398533], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|21398533], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by long chain acyl-CoA (C14 ... C20) ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]) [Pubmed|17189250]
  • expression of the operon is strongly induced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab



  • induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials


  • MGNA-B008 (ysiA::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A853 ( ''fadR''::''cat''), [Pubmed|17085570], available at [ BGSC]
  • BKE28550 ([gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTTCATCGTTCCTTCC, downstream forward: _UP4_AATAAGTAAAGGAGTTCTGT
  • BKK28550 ([gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTTCATCGTTCCTTCC, downstream forward: _UP4_AATAAGTAAAGGAGTTCTGT
  • References


  • 17919287,24006471
  • Original publications

  • 17189250,21398533,24356978