SubtiBank SubtiBank
serA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

serA

phosphoglycerate dehydrogenase
locus
BSU23070
pI
5.62
mw
56.95 kDa
protein length
525 aa Sequence Blast
gene length
1575 bp Sequence Blast
function
biosynthesis of serine
product
phosphoglycerate dehydrogenase
essential
no
ec
1.1.1.95
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.8|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,411,086 → 2,412,663

    The protein

    Catalyzed reaction/ biological activity

  • 3-phospho-D-glycerate + NAD+ = 3-phosphonooxypyruvate + NADH (according to Swiss-Prot)
  • Protein family

  • D-isomer specific 2-hydroxyacid dehydrogenase family (according to Swiss-Prot)
  • Modification

  • S-cysteinylation after diamide stress (C410)[Pubmed|17611193]
  • active site Cys410 is S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|21749987] [Pubmed|22938038]
  • Structure

  • [PDB|1YBA] (from ''E. coli'', 30% identity, 52% similarity) [Pubmed|15823035]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]
    description
    [Pubmed|7934830]

    regulation

  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • view in new tab

    Biological materials

    Mutant

  • 1A614 ( ''serA''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A614&Search=1A614 BGSC] and in [SW|Jörg Stülke]'s lab
  • BKE23070 (Δ[gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTAGATTTCCTCCTA, downstream forward: _UP4_TAATTAAAAAAACTCAAGCT
  • BKK23070 (Δ[gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTAGATTTCCTCCTA, downstream forward: _UP4_TAATTAAAAAAACTCAAGCT
  • lacZ fusion

  • pGP187 (in [protein|search|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References

  • 22938038,17611193,7934830,18763711,15823035,21749987,23033921,15378759