SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


16.05 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
de-bacillithiolation of S-bacillithiolated [protein|7A3A8AF7728474204396BB7A548F747D28E6FAC7|OhrR] and [protein|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|MetE]

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    2,493,064 2,493,501

    The protein

    Catalyzed reaction/ biological activity

  • de-bacillithiolation of S-bacillithiolated [protein|7A3A8AF7728474204396BB7A548F747D28E6FAC7|OhrR] and [protein|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|MetE] [Pubmed|24313874]
  • Protein family

  • UPF0403 family (with [protein|FBE3C55526FE0CBBDA71AE0B0D7C6AD074E8A63E|BrxA], according to UniProt)
  • Paralogous protein(s)

  • [protein|FBE3C55526FE0CBBDA71AE0B0D7C6AD074E8A63E|BrxA]
  • [SW|Domains]

  • contains an CxC redox motif redox active Cys residue [Pubmed|20308541]
  • Structure

  • [PDB|3FHK] ([protein|FBE3C55526FE0CBBDA71AE0B0D7C6AD074E8A63E|BrxA]) [Pubmed|19653655]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C380 (yqiW::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE23990 ([gene|8B134BDC82C92DB7747A3AF291C96BB0F223D0CF|brxB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAGACCTCTCCTTTT, downstream forward: _UP4_TAAGACGAACAACCCGGATG
  • BKK23990 ([gene|8B134BDC82C92DB7747A3AF291C96BB0F223D0CF|brxB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAGACCTCTCCTTTT, downstream forward: _UP4_TAAGACGAACAACCCGGATG
  • References

  • 24313874,20308541,19653655