SubtiBank SubtiBank
splA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

splA

transcriptional repressor of the spore photoproduct lyase splA-splB operon
locus
BSU_13920
pI
4.42
mw
9.08 kDa
protein length
gene length
240 bp Sequence Blast
function
regulation of the splA-splB operon
product
transcriptional regulator
essential
no
synonyms
ykxI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,461,453 1,461,692

    Expression and Regulation

    Operons

    genes
    [gene|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]-[gene|B873AE29ACAA0714D5F2E8648449B3280353C8AA|splB]
    description
    [Pubmed|8021181]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,8021181], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|SplA]: negative autoregulation, in [regulon|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|SplA regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • BKE13920 ([gene|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTATCCCTCCTAGCCA, downstream forward: _UP4_TAACAAGGAAATCATTACAA
  • BKK13920 ([gene|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTATCCCTCCTAGCCA, downstream forward: _UP4_TAACAAGGAAATCATTACAA
  • References

    Reviews

  • 23164663
  • Structure of the spore photoproduct lesion in DNA

  • 24598744
  • Original publications

  • 15699190,8021181,22761404,10629212