SubtiBank SubtiBank
alsR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

alsR

transcriptional activator of the [gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]-[gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD] operon
locus
BSU_36020
pI
7.29
mw
34.18 kDa
protein length
302 aa Sequence Blast
gene length
909 bp Sequence Blast
function
regulation of acetoin synthesis ([gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]-[gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD])
product
transcriptional activator ([SW|LysR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.5|Overflow metabolism]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,711,498 3,712,406

    Phenotypes of a mutant

  • reduced acetoin production [pubmed|31113899]
  • impaired biofilm development [pubmed|31113899]
  • The protein

    Catalyzed reaction/ biological activity

  • binds the promoter region of the [gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]-[gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD] operon in the presence of acetate, activates transcription [pubmed|30039521]
  • Protein family

  • [SW|LysR family] (according to UniProt)
  • Effectors of protein activity

  • acetate (2 molecules per molecule of AlsR) acts as co-factor that triggers activity [pubmed|30039521]
  • Structure

  • [PDB|2H98] (from Acinetobacter baylyi, 34% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]-[gene|EB8E3F88BC1ED2BAD5A98D609EDAA002261150A5|ywrK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • AMBs3 (spc), available in [SW|Jörg Stülke]'s lab
  • 1A978 ( ''alsR''::''cat''), [Pubmed|7685336], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A978&Search=1A978 BGSC]
  • BKE36020 ([gene|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATATGCATTCCTTT, downstream forward: _UP4_TGAACAATACTTGCAATCTC
  • BKK36020 ([gene|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATATGCATTCCTTT, downstream forward: _UP4_TGAACAATACTTGCAATCTC
  • labs

  • [SW|Elisabeth Härtig], Braunschweig, Germany [http://www.tu-braunschweig.de/ifm/abt/jahn/groups/bs Homepage]
  • References

    Reviews

  • 23046954
  • Original publications

  • 7685336,21821766,22344650,23576037,22178965,23695583,23836140,30039521,31113899