SubtiBank SubtiBank
ylnF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ylnF

probably precorrin-2 dehydrogenase
locus
BSU_15630
pI
9.24
mw
17.86 kDa
protein length
162 aa Sequence Blast
gene length
489 bp Sequence Blast
function
siroheme biosynthesis , sulfite reduction
product
probably precorrin-2 dehydrogenase
essential
no
synonyms
sirC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • Gene

    Coordinates
    1,635,603 1,636,091

    The protein

    Catalyzed reaction/ biological activity

  • NAD+ + precorrin-2 --> 2 H+ + NADH + sirohydrochlorin (according to UniProt)
  • Protein family

  • ferrochelatase family (with [protein|E4C588EC93132CCBE4F40559F8A480A66A2D82D7|HemH], according to UniProt)
  • Structure

  • [PDB|3DFZ] (36% identity) [pubmed|18588505]
  • Expression and Regulation

    Operons

    genes
    [gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]-[gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]-[gene|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]-[gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]-[gene|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD]-[gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]-[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]
    description
    [Pubmed|11004190]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11004190], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B370 (ylnF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1369 NBRP B. subtilis, Japan]
  • BKE15630 ([gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCACAACCTTCTTCTTTT, downstream forward: _UP4_TAAGCCAGAGCATACAAATG
  • BKK15630 ([gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCACAACCTTCTTCTTTT, downstream forward: _UP4_TAAGCCAGAGCATACAAATG
  • References

  • 10217486,16267287,11004190,12107147,18039762,18588505