SubtiBank SubtiBank
brnQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

brnQ

branched-chain amino acid transporter
locus
BSU_26690
pI
9.78
mw
46.84 kDa
protein length
440 aa Sequence Blast
gene length
1323 bp Sequence Blast
function
uptake of valine and isoleucine
product
branched-chain amino acid transporter
essential
no
synonyms
yrdJ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.12|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,727,160 2,728,482

    Phenotypes of a mutant

  • no phenotype for the single mutant, the triple ''[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ] [gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]'' mutant is strongly impaired in the transport of isoleucine and valine at low concentrations [Pubmed|25645558]
  • The protein

    Catalyzed reaction/ biological activity

  • high affinity uptake of isoleucine and valine [Pubmed|25645558]
  • Protein family

  • branched chain amino acid transporter family (together with [protein|75A874F0C344E8404BE39C32EFF59CE562193640|BraB]) (according to UniProt)
  • Paralogous protein(s)

  • [protein|75A874F0C344E8404BE39C32EFF59CE562193640|BraB]
  • Expression and Regulation

    Operons

    genes
    [gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]-[gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]-[gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK]
    description
    [Pubmed|9287000]

    regulatory mechanism

  • [protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|AzlB]: repression, [Pubmed|9287000], in [regulon|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|AzlB regulon]
  • regulation

  • repressed by [protein|search|AzlB] [Pubmed|9287000]
  • view in new tab

    Biological materials

    Mutant

  • BKE26690 ([gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATATCCTCCGATTA, downstream forward: _UP4_ATTCCAGCTATTGCAGGAGG
  • BKK26690 ([gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATATCCTCCGATTA, downstream forward: _UP4_ATTCCAGCTATTGCAGGAGG
  • References

  • 9287000,25645558