SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


branched-chain amino acid transporter
46.84 kDa
protein length
440 aa Sequence Blast
gene length
1323 bp Sequence Blast
uptake of valine and isoleucine
branched-chain amino acid transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|BCAA transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,727,160 2,728,482

    Phenotypes of a mutant

  • no phenotype for the single mutant, the triple ''[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ] [gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]'' mutant is strongly impaired in the transport of isoleucine and valine at low concentrations [Pubmed|25645558]
  • The protein

    Catalyzed reaction/ biological activity

  • high affinity uptake of isoleucine and valine [Pubmed|25645558]
  • Protein family

  • branched chain amino acid transporter family (together with [protein|75A874F0C344E8404BE39C32EFF59CE562193640|BraB]) (according to UniProt)
  • Paralogous protein(s)

  • [protein|75A874F0C344E8404BE39C32EFF59CE562193640|BraB]
  • Expression and Regulation



    regulatory mechanism

  • [protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|AzlB]: repression, [Pubmed|9287000], in [regulon|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|AzlB regulon]
  • regulation

  • repressed by [protein|search|AzlB] [Pubmed|9287000]
  • view in new tab

    Biological materials


  • BKE26690 ([gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATATCCTCCGATTA, downstream forward: _UP4_ATTCCAGCTATTGCAGGAGG
  • BKK26690 ([gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATATCCTCCGATTA, downstream forward: _UP4_ATTCCAGCTATTGCAGGAGG
  • References

  • 9287000,25645558