SubtiBank SubtiBank
gamA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gamA

glucosamine-6-phosphate deaminase
locus
BSU_02360
pI
5.79
mw
27.14 kDa
protein length
249 aa Sequence Blast
gene length
750 bp Sequence Blast
function
glucosamine utilization
product
glucosamine-6-phosphate deaminase
essential
no
synonyms
ybfT

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.3|Utilization of cell wall components]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.17|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.3|Utilization of amino sugars]
  • Gene

    Coordinates
    256,823 257,572

    Phenotypes of a mutant

  • no growth on glucosamine [Pubmed|23667565]
  • The protein

    Catalyzed reaction/ biological activity

  • α-D-glucosamine 6-phosphate + H2O --> β-D-fructose 6-phosphate + NH4+ (according to UniProt)
  • Protein family

  • glucosamine/galactosamine-6-phosphate isomerase family (with [protein|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|NagB], according to UniProt)
  • Paralogous protein(s)

  • [protein|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|NagB]
  • Kinetic information

  • K(M): 3.0 mM [Pubmed|14343123]
  • Structure

  • [PDB|2BKX] (the structure of [protein|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|NagB], 50% identity) [Pubmed|15755726]
  • Expression and Regulation

    Operons

    genes
    [gene|8BBC9AFF4CD56A3A66E270A2BBA193D095EE01D1|gamA]-[gene|4DF1740D4DFB9FD25E77C14D28AEA01707776099|gamP]
    description
    [Pubmed|23667565]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR]: repression, [Pubmed|24673833,23667565], in [regulon|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR regulon]
  • regulation

  • induced by glucosamine ([protein|search|GamR]) [Pubmed|24673833,23667565]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B938 (ybfT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1937 NBRP B. subtilis, Japan]
  • BKE02360 ([gene|8BBC9AFF4CD56A3A66E270A2BBA193D095EE01D1|gamA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGACACCCCCTCAAAG, downstream forward: _UP4_TAACACAATAAAAGGAGACT
  • BKK02360 ([gene|8BBC9AFF4CD56A3A66E270A2BBA193D095EE01D1|gamA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGACACCCCCTCAAAG, downstream forward: _UP4_TAACACAATAAAAGGAGACT
  • References

  • 10627040,14343123,23667565,23876412,24673833,15755726