SubtiBank SubtiBank
gamA [2018-02-11T05:38:57.000Z]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

gamA [2018-02-11T05:38:57.000Z]

glucosamine-6-phosphate deaminase
27.14 kDa
protein length
249 aa Sequence Blast
gene length
747 bp Sequence Blast
glucosamine utilization
glucosamine-6-phosphate deaminase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Utilization of cell wall components]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of amino sugars]
  • Gene

    256,823 → 257,572

    Phenotypes of a mutant

  • no growth on glucosamine [Pubmed|23667565]
  • The protein

    Catalyzed reaction/ biological activity

  • d-glucosamine 6-phosphate + H2O = D-fructose 6-phosphate + NH3 (according to Swiss-Prot)
  • Protein family

  • NagB subfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|NagB]
  • Kinetic information

  • K(M): 3.0 mM [Pubmed|14343123]
  • Structure

  • [PDB|2BKX] (the structure of [protein|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|NagB], 50% identity) [Pubmed|15755726]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR]: repression, [Pubmed|24673833,23667565], in [regulon|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR regulon]
  • regulation

  • induced by glucosamine ([protein|search|GamR]) [Pubmed|24673833,23667565]
  • view in new tab

    Biological materials


  • MGNA-B938 (ybfT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02360 (Δ[gene|8BBC9AFF4CD56A3A66E270A2BBA193D095EE01D1|gamA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGACACCCCCTCAAAG, downstream forward: _UP4_TAACACAATAAAAGGAGACT
  • BKK02360 (Δ[gene|8BBC9AFF4CD56A3A66E270A2BBA193D095EE01D1|gamA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGACACCCCCTCAAAG, downstream forward: _UP4_TAACACAATAAAAGGAGACT
  • References

  • 10627040,14343123,23667565,23876412,24673833,15755726