SubtiBank SubtiBank
panC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

panC

pantothenate synthase
locus
BSU_22420
pI
4.63
mw
31.81 kDa
protein length
286 aa Sequence Blast
gene length
861 bp Sequence Blast
function
biosynthesis of coenzyme A
product
pantothenate synthase
essential
no
ec
6.3.2.1
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.4|Biosynthesis of coenzyme A]
  • Gene

    Coordinates
    2,352,977 2,353,837

    The protein

    Catalyzed reaction/ biological activity

  • (R)-pantoate + ATP + β-alanine --> (R)-pantothenate + AMP + diphosphate + H+ (according to UniProt)
  • Protein family

  • pantothenate synthetase family (single member, according to UniProt)
  • Structure

  • [PDB|2EJC] (from ''Thermotoga maritima'', 50% identity, 66% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials

    Mutant

  • BKE22420 ([gene|8BE55434677F4EC3D6766C7163496CB1B659F57F|panC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATATCAGTAATCTGTC, downstream forward: _UP4_ATTCGAGAAATGGAGAGAAT
  • BKK22420 ([gene|8BE55434677F4EC3D6766C7163496CB1B659F57F|panC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATATCAGTAATCTGTC, downstream forward: _UP4_ATTCGAGAAATGGAGAGAAT